View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1392_low_13 (Length: 312)
Name: NF1392_low_13
Description: NF1392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1392_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 57 - 239
Target Start/End: Complemental strand, 29043796 - 29043614
Alignment:
| Q |
57 |
taggcctagtgctgtcagcaatgatgaggcactctactatgagactgccagtgtgattatatgtgctgttggagcccggtacaagagctactgctcaaat |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29043796 |
taggcctagtgctgtcagcaatgatgaggcactctactatgagactgccagtgtgattatatgtgctgttggagcccggtacaagagctactgctcaaat |
29043697 |
T |
 |
| Q |
157 |
atagctaggactttcttgattgatgcagaacctattcaaagcaaggcttatgaggttcttctgaaagcccatgaggcggttat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29043696 |
atagctaggactttcttgattgatgcagaacctattcaaagcaaggcttatgaggttcttctgaaagcccatgaggcggttat |
29043614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 139; Significance: 1e-72; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 57 - 239
Target Start/End: Original strand, 2824672 - 2824854
Alignment:
| Q |
57 |
taggcctagtgctgtcagcaatgatgaggcactctactatgagactgccagtgtgattatatgtgctgttggagcccggtacaagagctactgctcaaat |
156 |
Q |
| |
|
|||||||| | ||| |||||| || |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2824672 |
taggcctattactggcagcaacgacgaggcactctactatgagactgccagtgtgattatatgtgctcttggagcccggtacaagagctactgctcaaat |
2824771 |
T |
 |
| Q |
157 |
atagctaggactttcttgattgatgcagaacctattcaaagcaaggcttatgaggttcttctgaaagcccatgaggcggttat |
239 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
2824772 |
atagctagaactttcgtgattgatgcagaacctattcaaagtaaggcttatgaggttcttctcaaagcccatgaggccgttat |
2824854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University