View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13930_low_2 (Length: 349)
Name: NF13930_low_2
Description: NF13930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13930_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 1e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 47 - 203
Target Start/End: Complemental strand, 11975551 - 11975395
Alignment:
| Q |
47 |
cggaaaaggcaaccttgttgtgctggataacttgaaaactgagatacttggtgatgagatgctctctgatttggacaagatattaatgacatccaatggt |
146 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11975551 |
cggaaaaggaaaccttgttgtgctggataatttgaaaactgagatacttggggacgagatgctctctgatttggacaagatattaatgacgtccaatggt |
11975452 |
T |
 |
| Q |
147 |
gcaagtgcaatactcataaccacacgtagtaaacttgtggccaacaatatgactgtt |
203 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11975451 |
gcaagtgcaattctcataaccacacgtagtaaacttgtggccaacaatattactgtt |
11975395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University