View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13931_high_7 (Length: 311)
Name: NF13931_high_7
Description: NF13931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13931_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 133 - 305
Target Start/End: Original strand, 30465419 - 30465591
Alignment:
| Q |
133 |
atggtaccattgcaccattttagacccttacatgtatggggacatccttcaaatatggaccagtcttttatgcacatgtggcctacgccgcaaccgctgt |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30465419 |
atggtaccattgcaccattttagacccttacatgtatggggacatccttcaaatatggaccagtcttttatgcacatgtggcctacgctgcaaccgctgt |
30465518 |
T |
|
| Q |
233 |
catggacaccatcggcagatcctccaccacctcaagacccttcattttggcatgctcaccaccaacaggttag |
305 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30465519 |
catggacaccatcgccagatcctccaccacctcaagacccttcattttggcatgctcaccaccaacaggttag |
30465591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University