View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13932_high_5 (Length: 308)
Name: NF13932_high_5
Description: NF13932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13932_high_5 |
 |  |
|
| [»] scaffold0483 (1 HSPs) |
 |  |  |
|
| [»] scaffold0109 (1 HSPs) |
 |  |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0483 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0483
Description:
Target: scaffold0483; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 203 - 244
Target Start/End: Original strand, 3640 - 3681
Alignment:
| Q |
203 |
tagttaatgattaacaaatgattgaatagtaaaatgaacatt |
244 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3640 |
tagttaatgattaacaaatgattgaatagcaaaatgaacatt |
3681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0109 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0109
Description:
Target: scaffold0109; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 203 - 244
Target Start/End: Original strand, 48480 - 48521
Alignment:
| Q |
203 |
tagttaatgattaacaaatgattgaatagtaaaatgaacatt |
244 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
48480 |
tagttaatgattaacaaatgattgaatagcaaaatgaacatt |
48521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 203 - 244
Target Start/End: Complemental strand, 6787851 - 6787810
Alignment:
| Q |
203 |
tagttaatgattaacaaatgattgaatagtaaaatgaacatt |
244 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6787851 |
tagttaatgattaataaatgattgaatagtaaaatgaacatt |
6787810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 203 - 244
Target Start/End: Complemental strand, 6765421 - 6765380
Alignment:
| Q |
203 |
tagttaatgattaacaaatgattgaatagtaaaatgaacatt |
244 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
6765421 |
tagttaatgattaataaatgattgaataataaaatgaacatt |
6765380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 203 - 244
Target Start/End: Complemental strand, 28620472 - 28620431
Alignment:
| Q |
203 |
tagttaatgattaacaaatgattgaatagtaaaatgaacatt |
244 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28620472 |
tagttaatgattaacaaataattgaatagtaaaatgaacatt |
28620431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 203 - 244
Target Start/End: Original strand, 125988 - 126029
Alignment:
| Q |
203 |
tagttaatgattaacaaatgattgaatagtaaaatgaacatt |
244 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
125988 |
tagttaattattaacaaatgattgaatagcaaaatgaacatt |
126029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 207 - 244
Target Start/End: Complemental strand, 20027816 - 20027779
Alignment:
| Q |
207 |
taatgattaacaaatgattgaatagtaaaatgaacatt |
244 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20027816 |
taatgattaataaatgattgaatagtaaaatgaacatt |
20027779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 139 - 175
Target Start/End: Complemental strand, 20027929 - 20027893
Alignment:
| Q |
139 |
ttctttcaatttttgtgtttgaactgacatatttctt |
175 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
20027929 |
ttctttcaatttttgtgtttgagctgccatatttctt |
20027893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 203 - 244
Target Start/End: Original strand, 14694239 - 14694280
Alignment:
| Q |
203 |
tagttaatgattaacaaatgattgaatagtaaaatgaacatt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14694239 |
tagttaatgattaacaaatgattgaataacaaaatgaacatt |
14694280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 203 - 244
Target Start/End: Original strand, 14647765 - 14647806
Alignment:
| Q |
203 |
tagttaatgattaacaaatgattgaatagtaaaatgaacatt |
244 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
14647765 |
tagttaatgattaacaaatgattgaaaaacaaaatgaacatt |
14647806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University