View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13932_low_7 (Length: 250)
Name: NF13932_low_7
Description: NF13932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13932_low_7 |
 |  |
|
| [»] scaffold0288 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0288 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: scaffold0288
Description:
Target: scaffold0288; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 19 - 246
Target Start/End: Original strand, 4562 - 4791
Alignment:
| Q |
19 |
aatcactaatccaaaatctctcaaaagcaatcctacacactcaaggcctaaaaaa-ccttcactaaattttaaaa-atttcggaggtgttacatacatca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4562 |
aatcactaatccaaaatctctcaaaagcaatcctacacactcaaggcctaaaaaaaccttcactaaattttaaaaaatttcggaggtgttacatacatca |
4661 |
T |
 |
| Q |
117 |
ttgtcaatcatgatcttttcatgctctatagatgaattattaatgagttttaaatataatatatagaatagcttcagctctgctatagcctaaggttcac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4662 |
ttgtcaatcatgatcttttcatgctctatagatgaattattaatgagttttaaatataatatatagaatagcttcagctctgctatagcctaaggttcac |
4761 |
T |
 |
| Q |
217 |
atgaaatcccaaatattattcttctctctc |
246 |
Q |
| |
|
||||||||||||||||||||||| |||||| |
|
|
| T |
4762 |
atgaaatcccaaatattattcttttctctc |
4791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University