View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13933_high_6 (Length: 209)
Name: NF13933_high_6
Description: NF13933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13933_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 5e-61; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 1 - 154
Target Start/End: Original strand, 43602587 - 43602734
Alignment:
| Q |
1 |
tatgaaaatagatacaccgctgagattgctaatcaaactgtgatttcatttcaatttcatctaaagaatagatattttacacccccgtatttctggtgca |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43602587 |
tatgaaaatagatacaccgctgagattactaatcaaactgtgatttcattt------catctaaagaatagatattttacacccccatatttctggtgca |
43602680 |
T |
 |
| Q |
101 |
gtattttcagtttggggaatgggacctaaacaaccaatttgagactattctttc |
154 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43602681 |
gtatgttcagtttggggaatgggacctaaacaaccaatttgagactattctttc |
43602734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 168 - 209
Target Start/End: Original strand, 43602757 - 43602798
Alignment:
| Q |
168 |
caatttgagactatatatacatgccacttgacatattgatga |
209 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43602757 |
caatttgagattatatatacatgccacttgacatattgatga |
43602798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 43609130 - 43609175
Alignment:
| Q |
1 |
tatgaaaatagatacaccgctgagattgctaatcaaactgtgattt |
46 |
Q |
| |
|
||||| |||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
43609130 |
tatgagaatagatacaccactgagatttctaatcaaactgtgattt |
43609175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 43614420 - 43614464
Alignment:
| Q |
1 |
tatgaaaatagatacaccgctgagattgctaatcaaactgtgatt |
45 |
Q |
| |
|
||||| |||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
43614420 |
tatgagaatagatacaccactgagatttctaatcaaactgtgatt |
43614464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University