View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13933_low_5 (Length: 235)
Name: NF13933_low_5
Description: NF13933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13933_low_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 19 - 220
Target Start/End: Original strand, 6545425 - 6545626
Alignment:
| Q |
19 |
catctgtgtttctcatgagaataagaggaaacatgatgagaagaagagtgaaaggtacaagaaaaacacttttggttgtttttcttgttgtgtacttccc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6545425 |
catctgtgtttctcatgagaataagaggaaacatgatgagaagaagagtgaatggtacaagaaaaacacttttggttgtttttcttgttgtgtacttccc |
6545524 |
T |
|
| Q |
119 |
attgagaatctcattggtttgaaacttcatggttgagataaattttgaatataaaactttgatgaaacagtttatataaatgttggtaacttttgttatg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6545525 |
attgagaatctcattggtttgaaacttcatggttgagataaattttgaatataaaactttgatgaaacagtttatataaatgttggtaacttttgttatg |
6545624 |
T |
|
| Q |
219 |
at |
220 |
Q |
| |
|
|| |
|
|
| T |
6545625 |
at |
6545626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University