View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13933_low_7 (Length: 224)
Name: NF13933_low_7
Description: NF13933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13933_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 55; Significance: 9e-23; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 123 - 206
Target Start/End: Original strand, 44095219 - 44095298
Alignment:
| Q |
123 |
gcatctatgttgcatttgtggttttttccacctaacagtttcttgacagcttgaatgctcaacttagcttgaattcggttggtc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44095219 |
gcatctatgttgcatttgtggttttttcca----acagattcttgacagcttgaatgctcaacttgccttgaattcggttggtc |
44095298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 9 - 65
Target Start/End: Original strand, 44095158 - 44095214
Alignment:
| Q |
9 |
acatcatcatcacaaaggagagaaaaccatgcagttttggcaaggacaaagtctcta |
65 |
Q |
| |
|
|||||| |||||||||| |||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
44095158 |
acatcaacatcacaaagaagagaaaaccatgcggttttggcaaggacaaagtttcta |
44095214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University