View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13935_low_8 (Length: 204)

Name: NF13935_low_8
Description: NF13935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13935_low_8
NF13935_low_8
[»] chr2 (1 HSPs)
chr2 (23-179)||(29451292-29451448)


Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 23 - 179
Target Start/End: Complemental strand, 29451448 - 29451292
Alignment:
23 gaaactaagagcaaggctgcttgttcgggctaagctggtgcgtgctgaggaggtgaaggtgcggtcagtggtggtgctggtgaagctgaggtcgaggtcg 122  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
29451448 gaaactaagagcaaggctgcttgttcgggctaagctggtgcgtgctgaggaggtgaaggtgcgttcagtggtggtgctggtgaagctgaggtcgaggtcg 29451349  T
123 gaatcagggggtgggaatagaaatgttggttcttccatgaagattttgtgttattat 179  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29451348 gaatcagggggtgggaatagaaatgttggttcttccatgaagattttgtgttattat 29451292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University