View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13935_low_8 (Length: 204)
Name: NF13935_low_8
Description: NF13935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13935_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 23 - 179
Target Start/End: Complemental strand, 29451448 - 29451292
Alignment:
| Q |
23 |
gaaactaagagcaaggctgcttgttcgggctaagctggtgcgtgctgaggaggtgaaggtgcggtcagtggtggtgctggtgaagctgaggtcgaggtcg |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29451448 |
gaaactaagagcaaggctgcttgttcgggctaagctggtgcgtgctgaggaggtgaaggtgcgttcagtggtggtgctggtgaagctgaggtcgaggtcg |
29451349 |
T |
 |
| Q |
123 |
gaatcagggggtgggaatagaaatgttggttcttccatgaagattttgtgttattat |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29451348 |
gaatcagggggtgggaatagaaatgttggttcttccatgaagattttgtgttattat |
29451292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University