View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13936_low_5 (Length: 247)
Name: NF13936_low_5
Description: NF13936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13936_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 2 - 150
Target Start/End: Complemental strand, 10321580 - 10321432
Alignment:
| Q |
2 |
tcttaacatgagggcacaatatatacaaatgaagaagagagagatgcgactatcataataagaatttgtcgtttcttgaaagagctcttcataataaccg |
101 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
10321580 |
tcttaacatcagggcacaatatataccaatgaagaagagagagatgcgactatcataataagaatttgtcgtttcttgaaagagctcttcataataactg |
10321481 |
T |
 |
| Q |
102 |
ctttaggggtaggttaccatattaatttgaggtctttcttggagtttca |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10321480 |
ctttaggggtaggttaccatattaatttgaggtctttcttggagtttca |
10321432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University