View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13938_high_22 (Length: 363)
Name: NF13938_high_22
Description: NF13938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13938_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 1 - 345
Target Start/End: Complemental strand, 31216931 - 31216589
Alignment:
| Q |
1 |
tataaaccattggttgatgagaacgtgcatggcatgataggaaacgacaacaaccaaattttgttggttagtacatcctagtcatcacaacaagatacgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31216931 |
tataaaccattggttgatgagaacgtgcatggcatgataggaaacgacaacaaccaaattttgttggttagtacatcctagtcatcacaacaagatacgt |
31216832 |
T |
 |
| Q |
101 |
gttgcttaacttatgggccacattattgaatatatggatcaatgaacagaaacaaaatcagggtacatctcacatggttatgcccccttgccctttggag |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31216831 |
gttacttaacttatgggccacattattgaatatatggatcaatgaacagaaacaaaatcagggtacatctcacatggttatgcccccttgccctttggag |
31216732 |
T |
 |
| Q |
201 |
atataatagatagatatagattcatttgttcatctcttcaaccgtgggcatggccgttggattttctcaatttaattacaattacaataagaatgtcggt |
300 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31216731 |
atataatagatag--atagattcatttgttcatctcttcaaccgtgggcatggccgttggattttttcaatttaattacaattacaataagaatgtcggt |
31216634 |
T |
 |
| Q |
301 |
tgaataatgcacatcttatttggtatgggacatgcatctttgtgt |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31216633 |
tgaataatgcacatcttatttggtatgggacatgcatctttgtgt |
31216589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University