View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13938_high_38 (Length: 254)

Name: NF13938_high_38
Description: NF13938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13938_high_38
NF13938_high_38
[»] chr3 (1 HSPs)
chr3 (1-203)||(2571450-2571652)


Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 2571652 - 2571450
Alignment:
1 aaggtggaggagattgagctaggagtaataagggtgctaagaggatgaaaaggagaagggaaagtgaaggtgacatgnnnnnnnggaagtataatgaaag 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||| |||||||||    
2571652 aaggtggaggagattgagctaggagtaataagggtgctaagaggatgaaaaggagaagggaaagtgaaggtgacatgtttttttggaagtttaatgaaag 2571553  T
101 gtggtttgagtatgtgttattttgcttgtgggatgtgtttaggaataatggtagtactaggaatttataggcacatagacgaagttgttgagataaataa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2571552 gtggtttgagtatgtgttattttgcttgtgggatgtgtttaggaataatggtagtactaggaatttataggcacatagacgaagttgttgagataaataa 2571453  T
201 ata 203  Q
    |||    
2571452 ata 2571450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University