View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13938_high_39 (Length: 238)
Name: NF13938_high_39
Description: NF13938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13938_high_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 95 - 204
Target Start/End: Complemental strand, 37511293 - 37511184
Alignment:
| Q |
95 |
aatggagtaatagcttgggtttggcacaagcacatactttatgaattttttaatgggcttggaaaatgaatattttctcgttaatatgacccaaagatta |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37511293 |
aatggagtaatagcttgggtttggcacaagcacatactttatgaattttttaatgggcttggaaaatgaatatttgctcgttaatatgacccaaagatta |
37511194 |
T |
 |
| Q |
195 |
aacattaaac |
204 |
Q |
| |
|
|||||||||| |
|
|
| T |
37511193 |
aacattaaac |
37511184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 37511472 - 37511425
Alignment:
| Q |
1 |
ttcgctggtcagtgagaccactgattcaggtaatgaatagtacaacga |
48 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
37511472 |
ttcgctggtcagtgagatcactgattcgggtaatgaatagtacaacga |
37511425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 53752830 - 53752787
Alignment:
| Q |
1 |
ttcgctggtcagtgagaccactgattcaggtaatgaatagtaca |
44 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
53752830 |
ttcgccggtcagtgagatcactgattcaggtaatgaatagtaca |
53752787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University