View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13938_high_39 (Length: 238)

Name: NF13938_high_39
Description: NF13938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13938_high_39
NF13938_high_39
[»] chr7 (2 HSPs)
chr7 (95-204)||(37511184-37511293)
chr7 (1-48)||(37511425-37511472)
[»] chr4 (1 HSPs)
chr4 (1-44)||(53752787-53752830)


Alignment Details
Target: chr7 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 95 - 204
Target Start/End: Complemental strand, 37511293 - 37511184
Alignment:
95 aatggagtaatagcttgggtttggcacaagcacatactttatgaattttttaatgggcttggaaaatgaatattttctcgttaatatgacccaaagatta 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
37511293 aatggagtaatagcttgggtttggcacaagcacatactttatgaattttttaatgggcttggaaaatgaatatttgctcgttaatatgacccaaagatta 37511194  T
195 aacattaaac 204  Q
    ||||||||||    
37511193 aacattaaac 37511184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 37511472 - 37511425
Alignment:
1 ttcgctggtcagtgagaccactgattcaggtaatgaatagtacaacga 48  Q
    ||||||||||||||||| ||||||||| ||||||||||||||||||||    
37511472 ttcgctggtcagtgagatcactgattcgggtaatgaatagtacaacga 37511425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 53752830 - 53752787
Alignment:
1 ttcgctggtcagtgagaccactgattcaggtaatgaatagtaca 44  Q
    ||||| ||||||||||| ||||||||||||||||||||||||||    
53752830 ttcgccggtcagtgagatcactgattcaggtaatgaatagtaca 53752787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University