View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13938_low_16 (Length: 428)
Name: NF13938_low_16
Description: NF13938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13938_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-121; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 94 - 415
Target Start/End: Original strand, 33227411 - 33227762
Alignment:
| Q |
94 |
aacaagataaactggaatatattactatgaaaaaagcactatgtctagcacaagcagtgctaaaacataaggtgccaaatcaaacaatgcaaatgaacaa |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33227411 |
aacaagataaactggaatatattactatgaaaaaagcattatgtctagcacaagcagtgctaaaacataaggtgccaaatcaaacaatgcaaatgaacaa |
33227510 |
T |
|
| Q |
194 |
aattacttgctgaaactcaaacacaccaattatgataataatggtt-aattatcccgtgtgatcttctctaggcatgcaataatttcacgcat------- |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||||||||| |||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33227511 |
aattacttgctgaaactcaaacacaccaattttgatcataatggttaaattatcccgtgtgatcttctctaggcatgcaatgatttcacgcatacttaat |
33227610 |
T |
|
| Q |
286 |
--------------actcattcatattatattctcatatttgcaaaatttgcccacataatatttccatctatgcgatccccattcaa---------ttc |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
33227611 |
ttttctttcaaatcactcattcatattatattctcatatttgcaaaatttgcccacataatatttccatctatgcgatccccattcaacaaccatggttc |
33227710 |
T |
|
| Q |
363 |
aatgtaaaaaagtctttaaaaatatcaattcaatcaccccctaaacacaatga |
415 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33227711 |
-atgtaaaaaagtctttaaaaatatcaattcaatcaccccctaaacacaatga |
33227762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 33227313 - 33227359
Alignment:
| Q |
1 |
cttaaattttatccaaataaaaaatatgatagaaatctctaataata |
47 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33227313 |
cttaaattttatccaaataaaaaataggatagaaatctctaataata |
33227359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 253 - 288
Target Start/End: Original strand, 33219205 - 33219240
Alignment:
| Q |
253 |
gatcttctctaggcatgcaataatttcacgcatact |
288 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33219205 |
gatcttctctaggcatgcaataatttcaggcatact |
33219240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University