View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13938_low_19 (Length: 414)
Name: NF13938_low_19
Description: NF13938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13938_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 1e-69; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 17 - 166
Target Start/End: Original strand, 5368221 - 5368370
Alignment:
| Q |
17 |
acttttgaagcaaatgattgtaattttgtgaagctctaaagggtattccttaccaaaattacaatagtttaccacgattctgctgatgccatcatcaacc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5368221 |
acttttgaagcaaatgattgtaattttgtgaagctctaaagtgtattccttgccaaaattacaatagtttaccacgattctgctgatgccatcatcaacc |
5368320 |
T |
 |
| Q |
117 |
caaacatgcgtagtgttttgaatttgaaattcaaacatttaatataattg |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5368321 |
gaaacatgcgtagtgttttgaatttgaaattcaatcatttaatataattg |
5368370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 215 - 406
Target Start/End: Original strand, 5368417 - 5368617
Alignment:
| Q |
215 |
acgtattcgcaccctattcttaatttatttcaccaaaaaagataatgcttcgataaaaaattcgtttgagacaaatacttatgannnnnnnn-------- |
306 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5368417 |
acgtattcgcaccctattcttaatttgtttcaccaaaaaagataatgcttcgataaaaaattcgtttgggacaaatacttatgattttttttttattttt |
5368516 |
T |
 |
| Q |
307 |
-atcaaagtagattagcgggctctgaagcccatatacttaaaaatgaatgacgtaccaatatcctatcatatcatgcatcgatacatgtctgatattctt |
405 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| ||||||||||||||| |
|
|
| T |
5368517 |
catcaaagtagattagtgggctccgaagcccatatacttaaaaatgaatgacgtaccaatatcctatcgtatcctgcatcgatatatgtctgatattctt |
5368616 |
T |
 |
| Q |
406 |
c |
406 |
Q |
| |
|
| |
|
|
| T |
5368617 |
c |
5368617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University