View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13938_low_3 (Length: 595)
Name: NF13938_low_3
Description: NF13938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13938_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 6e-97; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 6e-97
Query Start/End: Original strand, 205 - 409
Target Start/End: Original strand, 49202027 - 49202231
Alignment:
| Q |
205 |
ttggtatggtattggtatttactatttacattgcgaacaagaaatatatgtctataattttgtaatcaactggcaggttaaaactacgtcgccgaagaag |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
49202027 |
ttggtatggtattggtatttactatttacattgcgaacaagaaatatatgtctataattttgtaatcaattggcaggttaaaactacgtcgccgaagaag |
49202126 |
T |
|
| Q |
305 |
tactgcgttagacctaatataggcatcatcaagccaaaggataaatgtgatttcactggtannnnnnncatttaccttcttgtttaaggctcaattcatt |
404 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
49202127 |
tactgcgttagacctaatataggcatcatcaagccaaaggataaatgtgatttcactggtatttttttcatttaccttcttgtttaaggctcaattcatt |
49202226 |
T |
|
| Q |
405 |
tcata |
409 |
Q |
| |
|
||||| |
|
|
| T |
49202227 |
tcata |
49202231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 132; E-Value: 3e-68
Query Start/End: Original strand, 446 - 585
Target Start/End: Original strand, 49202266 - 49202405
Alignment:
| Q |
446 |
agtatgattcaagtaacacaagttactggcttatgtttattttttggatgtactagttacgatgcaagctcaacgcacggcaccgcctgatatgcattgc |
545 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
49202266 |
agtatgattcaagtaacacaagttattggcttatgtttattttttggatgtactagttacgatgcaagctcaacgcacggcaccccctgatatgcattgc |
49202365 |
T |
|
| Q |
546 |
aaagacaagtttcttattataagcactgttgtcccctttg |
585 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49202366 |
aaagacaagtttcttattataagcactgttgtcccctttg |
49202405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 127; E-Value: 3e-65
Query Start/End: Original strand, 17 - 167
Target Start/End: Original strand, 49201883 - 49202028
Alignment:
| Q |
17 |
acaaagttcatgtttgattcaacttgcaaacaagattgatcagtacattgcttttaaggtacgtcggtaccacaactatttactcaattatcactctttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
49201883 |
acaaagttcatgtttgattcaacttgcaaacaagattgatcagtacattgcttttaaggtacgttggtaccacaactatttactcaattatcactctttt |
49201982 |
T |
|
| Q |
117 |
ctttacattacattacattacacccttttactgtatgataataatgttatt |
167 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49201983 |
ct-----ttacattacattacacccttttactgtatgataataatgttatt |
49202028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University