View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13938_low_38 (Length: 263)
Name: NF13938_low_38
Description: NF13938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13938_low_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 31786075 - 31785835
Alignment:
| Q |
1 |
cttatatagtgtcggagagtttctcgattattggttgttcatatatcatgactcattttatagaacacctgtgcaaatactccaagtagaagaaacatgc |
100 |
Q |
| |
|
|||||| ||||| | |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
31786075 |
cttatacagtgttgtagagtttctcgattattggttgttcatatatcatgaatcattttatagaacacctgtgc-------ccaagtggaagaaacatgc |
31785983 |
T |
 |
| Q |
101 |
acatggagttgaaaagatgtaatcgggtcaataatcactccattagtactacattgaattgaatgctggaaagaaggaaatggaagatgtccacattgat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31785982 |
acatggagttgaaaagatgtaatcgggtcaataatcactccattagtactaaattgaattgaatgctggaaagaaggaaatggaagatgtccacattgat |
31785883 |
T |
 |
| Q |
201 |
cattaggagatggaagaacatgtacatggagtattgcacttgcttatt |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31785882 |
cattaggagatggaagaacatgtacatggagtattgcacttgcttatt |
31785835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University