View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1393_low_14 (Length: 296)
Name: NF1393_low_14
Description: NF1393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1393_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 10 - 269
Target Start/End: Complemental strand, 3685923 - 3685664
Alignment:
| Q |
10 |
tcatagggggcagtggtgcagcatgagaaactatatgtgtctcatctatcacttgttacacaacctttcatgcttggttgctcatcttatattgctagtt |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3685923 |
tcataaggggcagtggtgcagcatgagaaactatatgtgtctcatctatcacttgttacgcaacctttcatgcttggttgctcatcttatattgctagtc |
3685824 |
T |
 |
| Q |
110 |
atgcttcatcagtacgtggctgagcatcacctgttactgttaattcagattgcacaactatatgttcattgactggaggtgaacatttcgagcaaatggt |
209 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3685823 |
gtgcttcatcagtacgtggttgaaaatcacctgttactgttaattcagattgcacaactatatgttcattgactggaggtgaacatttcgagcaaatggt |
3685724 |
T |
 |
| Q |
210 |
gtcttaattgctttcgaaaaacctatgcatgcagggttatcttttgcttgcctggtttct |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3685723 |
gtcttaattgctttcgaaaaacctatgcatgcagggttatcttttgcttgcctggtttct |
3685664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University