View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1393_low_15 (Length: 292)
Name: NF1393_low_15
Description: NF1393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1393_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 46 - 282
Target Start/End: Complemental strand, 9667583 - 9667347
Alignment:
| Q |
46 |
gtacctttaacatagcggataatacgaagaactgcagagaaatgagatgaccgaggagcagccataaattgattgactttatggacagcatatgcaatat |
145 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |||||| ||||| |
|
|
| T |
9667583 |
gtacctttaacatagcagataatacgaagaactgcagagaaatgagatgaccgaggagcggccataaattgactgactttatggacaacatatggaatat |
9667484 |
T |
 |
| Q |
146 |
cagggcgagtaacagtcaggtaaacaagactaccaacaagttgtcgatacagggtgacatcttcaagaggagtgccgtcaagtggtttgagtttgcagtt |
245 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
9667483 |
cagggtgagtaacagtcaggtaaacaagactaccaacaagttgtcgatacatggtgacatcttcaagaggagtgtcgtcaagtggtgtgagtttgcagtt |
9667384 |
T |
 |
| Q |
246 |
tacttccaatggtgtcaatttagtcttgcagtctgtg |
282 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9667383 |
tacttccaatggtgtcaattcagtcttgcagtctgtg |
9667347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University