View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1393_low_23 (Length: 209)

Name: NF1393_low_23
Description: NF1393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1393_low_23
NF1393_low_23
[»] chr8 (1 HSPs)
chr8 (50-190)||(5441379-5441519)


Alignment Details
Target: chr8 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 50 - 190
Target Start/End: Complemental strand, 5441519 - 5441379
Alignment:
50 catacaataactatgaacatatctataaagttgatagaatgggtaacctcccatacctgatccaaatgaacatcactatgtagttacaacttgagaagat 149  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
5441519 catacaataactatgaacatatctataaagttgatagaatgggtaacctcccatacctgatccaaatgaacatcaatatgtagttacaacttgagaagat 5441420  T
150 tgatagcattcaatttgtgagtcattatctatttgcctatg 190  Q
     ||||||||||||||| ||||||||||||||||||||||||    
5441419 agatagcattcaatttatgagtcattatctatttgcctatg 5441379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University