View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13940_high_71 (Length: 238)
Name: NF13940_high_71
Description: NF13940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13940_high_71 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 178
Target Start/End: Complemental strand, 3752287 - 3752110
Alignment:
| Q |
1 |
ttcctccattggaaatggtcttaggggttaatatatgtgtggatgttttggcacttagatgttttaaggttaactattccgttcaacaattactagagga |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3752287 |
ttcctccattggaaatgatcttaggggttaatatatgtgtggatgttttggcacttagatgttttaaggttaactattccgttcaacaattactagagga |
3752188 |
T |
 |
| Q |
101 |
ccgaaagataaaatacttacattggtgtcccttccataatctaaattcttatctatcacagatgaccaaaagattgtt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3752187 |
ccgaaagataaaatacttacattggtgtcccttccataatctaaattcttatctatcacagatgaccaaaagattgtt |
3752110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University