View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13940_high_77 (Length: 206)
Name: NF13940_high_77
Description: NF13940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13940_high_77 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 19 - 191
Target Start/End: Complemental strand, 3298269 - 3298084
Alignment:
| Q |
19 |
ccaattaaaaatcccttgccgcatttgagcaaaagatgaacactnnnnnnntaaatgttgcagagtttcatcaca-------------agctatatgtaa |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3298269 |
ccaattaaaaatcccttgccgcatttgagcaaaagatgaacactaaaaaaataaatgttgcagagtttcatcacacctctacaaaccaagctatatgtaa |
3298170 |
T |
 |
| Q |
106 |
tctattatttgaaagctttaatgcatgcaaagacacttttataggaactatgtgaatgtgattccaaagacaggcatgtaaggaag |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3298169 |
tctattatttgaaagctttaatgcatgcaaagacacttttataggaactatgtgaatgtgattccaaagacaggcatgtaaggaag |
3298084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University