View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13940_low_16 (Length: 490)
Name: NF13940_low_16
Description: NF13940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13940_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 100; Significance: 3e-49; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 142 - 278
Target Start/End: Complemental strand, 48018608 - 48018468
Alignment:
| Q |
142 |
gaagaaacattattcgatatgaagaaattcaaatnnnnnnnn----cattattctgaagcttttgataattgcactagttaggtcagtccggagctttat |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48018608 |
gaagaaacattattcgatatgaagaaattcaaattaaaaaaaaaaacattattctgaagcttttgataattgcactagttaggtcagtccggagctttat |
48018509 |
T |
 |
| Q |
238 |
ggtgacagcagacccagattatttacttactggacggttag |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48018508 |
ggtgacagcagacccagattatttacttactggacggttag |
48018468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 372 - 468
Target Start/End: Complemental strand, 48018405 - 48018313
Alignment:
| Q |
372 |
tattctctaattttactcgttaaaattcttgttgattaaacaatttaattataagcacgcagagtgacacatatcaagcaactggatgctacaacct |
468 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48018405 |
tattctctaattttactcgttaaaattcttgttgattaaacaattta----taagcacgcagagtgacacatatcaagcaactggatgctacaacct |
48018313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 11 - 49
Target Start/End: Complemental strand, 48018847 - 48018809
Alignment:
| Q |
11 |
ttattctaaactccaattttcaatttcagattatagtaa |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48018847 |
ttattctaaactccaattttcaatttcagattatagtaa |
48018809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 213 - 275
Target Start/End: Original strand, 35408657 - 35408719
Alignment:
| Q |
213 |
tagttaggtcagtccggagctttatggtgacagcagacccagattatttacttactggacggt |
275 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||||||||||||| || || |||||||| |
|
|
| T |
35408657 |
tagtcaggtcagtccggagctttatggtgacaacagacccagattattcacgtattggacggt |
35408719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University