View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13940_low_39 (Length: 364)
Name: NF13940_low_39
Description: NF13940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13940_low_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 18 - 354
Target Start/End: Original strand, 5191170 - 5191509
Alignment:
| Q |
18 |
agagatgtcgttgtttgccgatcttggtgagttgccggagtgttcggcggtgttttggagaggtaggaggagtggtgccggcgccggcgccggtggtgat |
117 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5191170 |
agagatgtcgttgtttgcagatcttggtgagttgccggagtgttcggcggtgttttggagaggtaggaggagtggtgccggcgccggcgccagtggtgat |
5191269 |
T |
 |
| Q |
118 |
gttagtgtgggaccactggttgaagctaattgctcgttgtgacacgtgtctttgtannnnnnnnnnnnnnnnnnnnnnnccgggtttgttgggtttagtt |
217 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5191270 |
gttagtgtgggaccactagttgaagctaattgctcgttgtgacacgtgtctttgtattttttatttattttttaattttccgggtttgttgggtttagtt |
5191369 |
T |
 |
| Q |
218 |
tggaagaaaacaaaaatgaaatacaacaagtggatatatgcagttgggagattctgtccccacgtgcttgtaattattatatcaactacatgattatg-- |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5191370 |
tggaagaaaacaaaaatgaaatacaacaagtggatatatgcagttgggagattctgtccccacgtgcttgtaattat--tatcaactacatgattatgaa |
5191467 |
T |
 |
| Q |
316 |
---attatcatattaagttcttaatttgatgctttattcata |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5191468 |
atcattatcatattaagttcttaatttgatgctttattcata |
5191509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University