View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13940_low_45 (Length: 329)
Name: NF13940_low_45
Description: NF13940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13940_low_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 18 - 321
Target Start/End: Original strand, 8446832 - 8447135
Alignment:
| Q |
18 |
agtagtgaatattgggaagatgtgaaaggtcggcaagtgtgaactcatcaccagccaagtagcgagtttccccaagcctcttatcgtacacatcaagcac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8446832 |
agtagtgaatattgggaagatgtgaaaggtcggcaagtgtgaattcatcaccagccaagtagcgagtttccccaagcctcttatcgtacacatcaagcac |
8446931 |
T |
 |
| Q |
118 |
tttcttgagcttttctttactctgtcgaattgctccttcgtcttgtttgatcttcattcgaggagcaaatgcaagctgaaacaccagagttgaagaaggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8446932 |
tttcttgagcttttctttactctgtcgaattgctccttcgtcttgtttgatcttcattcgaggagcaaatgcaagctgaaacaccagagttgaagaaggt |
8447031 |
T |
 |
| Q |
218 |
ggattgaagctttgtccttcagcttctaaccattgatctattgaagcctttgccaatggatttgtatcatacagttgtttgttccctttctctctattct |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| | |
|
|
| T |
8447032 |
ggattgaagctttgtccttcagcttctaaccattgatctattgaagcctttgccaatggatttgtaccatacagttgtttgttccctttctctatatttt |
8447131 |
T |
 |
| Q |
318 |
tctc |
321 |
Q |
| |
|
|||| |
|
|
| T |
8447132 |
tctc |
8447135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University