View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13940_low_46 (Length: 327)
Name: NF13940_low_46
Description: NF13940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13940_low_46 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 11 - 311
Target Start/End: Complemental strand, 29037828 - 29037523
Alignment:
| Q |
11 |
atcatcatgaataaatttttagctcagatcctttaaggtggatgttgcttctgcagctaaggatcaattgttactgtgagattaacactcagtcaataga |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29037828 |
atcatcatgaataaatttttagctcagatcctttaaggtcgatgttgcttctgcagctaaggatcaattgttactgtgagattaacactcagtcaataga |
29037729 |
T |
 |
| Q |
111 |
taaatgttacaaccaacatctagtggcagaagcaacagaggctgcatagaaccctcatgctcatagtcataattttttgttctttcagatttaaagcaat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29037728 |
taaatgttacaaccaacatctagtggcagaagcaacagaggctgcatagaaccctcatgctcatagtcatacttttttgttctttcagatttaaagcaat |
29037629 |
T |
 |
| Q |
211 |
catgagaatacttactagtatatatatat-tttttaaa----catcatattataaaagctatactgtacaagaagaatggcaaagctagagaatagaact |
305 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29037628 |
catgagaatacttactagtatatatatatatttttcaaacatcatcatattataaaagctatactgtacaagaagaatggcaaagctagagaatagaact |
29037529 |
T |
 |
| Q |
306 |
acaacg |
311 |
Q |
| |
|
|||||| |
|
|
| T |
29037528 |
acaacg |
29037523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University