View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13940_low_53 (Length: 300)
Name: NF13940_low_53
Description: NF13940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13940_low_53 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 9 - 188
Target Start/End: Complemental strand, 40223630 - 40223451
Alignment:
| Q |
9 |
ttattctagcaaaacatttctgaagtattattattattgacttctnnnnnnnttgaattaactcttgtgtaggatgtttgtggggacgtggaatgttggg |
108 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40223630 |
ttattttagcaaaacatttctgaagtattattattattgacttctaaaaaaattgaattaactcttgtgtaggatgtttgtggggacgtggaatgttggg |
40223531 |
T |
|
| Q |
109 |
ggaaagtcaccaaatgaaaatttggacttgaaaaattggctgatatctacttcgccagctgacatatatgttattgggta |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40223530 |
ggaaagtcaccaaatgaaaatttggacttgaaaaattggctgatatctacttcgccagctgacatatatgttattgggta |
40223451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 216 - 285
Target Start/End: Complemental strand, 40223424 - 40223355
Alignment:
| Q |
216 |
acttaatcttatcatctatgttccctatttggctatctactactttgtctgtagtattttatttattttt |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40223424 |
acttaatcttatcatctatgttccctatttggctatctactactttgtctgtagtattttatttattttt |
40223355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University