View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13940_low_59 (Length: 280)
Name: NF13940_low_59
Description: NF13940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13940_low_59 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 17 - 261
Target Start/End: Complemental strand, 52630934 - 52630687
Alignment:
| Q |
17 |
agcaaaggagagacgattgcggtggttcgaccagcgtcggccaatgacgtggcaagggtagttaaagcggcgtataaatggcagaagt---ttgcggtgt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
52630934 |
agcaaaggagagacgattgcggtggttcgaccagcgtcggccaatgacgtggcaagggtagttaaagcggcgtataaatggcagcagtactttgcggtgt |
52630835 |
T |
|
| Q |
114 |
cagcgagaggacacggacactcaataaacggacaagcagatacagggatgaaaggagtggtgattgaaatgggaaaaggaggtgtaggaattaagggtcc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52630834 |
cagcgagaggacacggacactcaataaacggacaagcggatacaaggatgaaaggagtggtgattgaaatgggaaaaggaggtgtaggaattaagggtcc |
52630735 |
T |
|
| Q |
214 |
tctaatttgggagaaagaaatgtatgtggatgtttggggtggtgaatt |
261 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52630734 |
tctagtttgggagaaagaaatgtatgtggatgtttggggtggtgaatt |
52630687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University