View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13940_low_70 (Length: 239)
Name: NF13940_low_70
Description: NF13940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13940_low_70 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 42966784 - 42966562
Alignment:
| Q |
1 |
agtattttccaaaaataaatataacatgagatgtactattaaaacatataaacataaaccgtaactatcaataagttgtcaccgtgagttgataaatatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42966784 |
agtattttccaaaaataaatataacatgagatgtactattaaaacagataaacataaaccgtaactatcaataagttgtcaccgtgagttgatgaatatt |
42966685 |
T |
 |
| Q |
101 |
aatcgttttttaatgacaaatactagtatgctggttattatgttagtttattcttgttgcaagaacttgaaacgtgaatctcaaattcttaacctttaac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42966684 |
aatcgttttttaatgacaaatactagtatgctgattattatgttagtttgttcttgttgcaagaacttgaaacgtgaatctcaaattcttaacctttaac |
42966585 |
T |
 |
| Q |
201 |
tcgaagagatgaactattcaaac |
223 |
Q |
| |
|
|| |||||||||||||||||||| |
|
|
| T |
42966584 |
tcaaagagatgaactattcaaac |
42966562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University