View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13940_low_73 (Length: 238)

Name: NF13940_low_73
Description: NF13940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13940_low_73
NF13940_low_73
[»] chr7 (1 HSPs)
chr7 (1-178)||(3752110-3752287)


Alignment Details
Target: chr7 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 178
Target Start/End: Complemental strand, 3752287 - 3752110
Alignment:
1 ttcctccattggaaatggtcttaggggttaatatatgtgtggatgttttggcacttagatgttttaaggttaactattccgttcaacaattactagagga 100  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3752287 ttcctccattggaaatgatcttaggggttaatatatgtgtggatgttttggcacttagatgttttaaggttaactattccgttcaacaattactagagga 3752188  T
101 ccgaaagataaaatacttacattggtgtcccttccataatctaaattcttatctatcacagatgaccaaaagattgtt 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3752187 ccgaaagataaaatacttacattggtgtcccttccataatctaaattcttatctatcacagatgaccaaaagattgtt 3752110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University