View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13940_low_76 (Length: 221)

Name: NF13940_low_76
Description: NF13940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13940_low_76
NF13940_low_76
[»] chr5 (1 HSPs)
chr5 (1-167)||(1652090-1652256)


Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 167
Target Start/End: Original strand, 1652090 - 1652256
Alignment:
1 ttgaactttaggtttcatctaattactacctaacactttcttcttaatgtcccagagtggttgtttgagggctgtggctgcatgttactgtattttcctg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1652090 ttgaactttaggtttcatctaattactacctaacactttcttcttaatgtcccagagtggttgtttgagggctgtggctgcatgttactgtattttcctg 1652189  T
101 tcttattggaagatcatatgattcgttaaattgattgatattactagatattaggggaggaaattgt 167  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1652190 tcttattggaagatcatatgattcgttaaattgattgatattactagatattaggggaggaaattgt 1652256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University