View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13940_low_77 (Length: 220)
Name: NF13940_low_77
Description: NF13940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13940_low_77 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 11 - 175
Target Start/End: Original strand, 14160286 - 14160450
Alignment:
| Q |
11 |
gagtagcataggattgtttggttgatatcatcatcaacttggtgctacctaggcctatctatgcccatatgggccaagttgtctcatactttgatcacaa |
110 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14160286 |
gagtagcagaggattgtttggttgatttcatcatcaacttggtgctacctaggcctatctatgcccatatgggccaagttgtctcatactttgatcacaa |
14160385 |
T |
|
| Q |
111 |
agaataatagacccataaacatttatgttgattaacatttataactagttcatgtgtatgagtac |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14160386 |
agaataatagacccataaacatttatgttgattaacatttataactagttcatgtgtatgtgtac |
14160450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 201
Target Start/End: Original strand, 14160488 - 14160516
Alignment:
| Q |
173 |
tacttaattgactgatcacactggctact |
201 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
14160488 |
tacttaattgactgatcacactggctact |
14160516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University