View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13940_low_78 (Length: 210)
Name: NF13940_low_78
Description: NF13940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13940_low_78 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 5 - 195
Target Start/End: Complemental strand, 36604538 - 36604348
Alignment:
| Q |
5 |
atggacatcatcacaaagcttatgaggaggtacaaacaggttcctgagtggtggtttgtgtgcatactcattgcaaccattggaactaccatttttgcat |
104 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36604538 |
atggacatccacacaaagcttatgaggaggtacaaacaggttcctgagtggtggtttgtgtgcatactcattgcaaccattgcaactaccatttttgcat |
36604439 |
T |
|
| Q |
105 |
gtgaatattacaatgaacagctacaattaccttggtggggtgttctgttagcatgtggcattgctatcttcttcactctccccattggtat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36604438 |
gtgaatattacaatgaacagctacaattaccttggtggggtgttctgttagcatgtggcattgctatcttcttcaccctccccattggtat |
36604348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University