View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13941_high_3 (Length: 276)
Name: NF13941_high_3
Description: NF13941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13941_high_3 |
 |  |
|
| [»] scaffold0166 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0166 (Bit Score: 183; Significance: 5e-99; HSPs: 2)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 18 - 264
Target Start/End: Original strand, 22523 - 22765
Alignment:
| Q |
18 |
atgataagtagttttactagttttctgctgaatctgagttcgtttgcgatcgtaaaccatccttgattgagtcttgggcgttggaactgttaggttttgt |
117 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22523 |
atgataagtacttttactagttttctgctgaatctgagttcgtttgcgatcataaaccatccttgattgagtcttgggcgttggaactgttaggttttgt |
22622 |
T |
 |
| Q |
118 |
agataaaatggttcagcatttggattaagatcataaatacgttgttgcattgtgatgggattgggaatgaaagggnnnnnnnnnggtgaaatagttgttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
22623 |
ggataaaatggttcagcatttggattaagatcataaatacgttgttgcattgtcatgggattgggaatggaaggg----tttttggtgaaatagttgttt |
22718 |
T |
 |
| Q |
218 |
tggtggaaatggcaaaaggtgatgaaagaaggtggagtcattgtgat |
264 |
Q |
| |
|
||||||||||||| |||| |||||||||||| ||||||||||||||| |
|
|
| T |
22719 |
tggtggaaatggcgaaagatgatgaaagaagatggagtcattgtgat |
22765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 110 - 171
Target Start/End: Complemental strand, 32266 - 32205
Alignment:
| Q |
110 |
ggttttgtagataaaatggttcagcatttggattaagatcataaatacgttgttgcattgtg |
171 |
Q |
| |
|
|||||||| || ||||||||| ||||||||||||||||| | |||| ||||||||||||||| |
|
|
| T |
32266 |
ggttttgtggaaaaaatggttgagcatttggattaagatgagaaatgcgttgttgcattgtg |
32205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 183; Significance: 5e-99; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 18 - 264
Target Start/End: Original strand, 24780140 - 24780382
Alignment:
| Q |
18 |
atgataagtagttttactagttttctgctgaatctgagttcgtttgcgatcgtaaaccatccttgattgagtcttgggcgttggaactgttaggttttgt |
117 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24780140 |
atgataagtacttttactagttttctgctgaatctgagttcgtttgcgatcataaaccatccttgattgagtcttgggcgttggaactgttaggttttgt |
24780239 |
T |
 |
| Q |
118 |
agataaaatggttcagcatttggattaagatcataaatacgttgttgcattgtgatgggattgggaatgaaagggnnnnnnnnnggtgaaatagttgttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
24780240 |
ggataaaatggttcagcatttggattaagatcataaatacgttgttgcattgtcatgggattgggaatggaaggg----tttttggtgaaatagttgttt |
24780335 |
T |
 |
| Q |
218 |
tggtggaaatggcaaaaggtgatgaaagaaggtggagtcattgtgat |
264 |
Q |
| |
|
||||||||||||| |||| |||||||||||| ||||||||||||||| |
|
|
| T |
24780336 |
tggtggaaatggcgaaagatgatgaaagaagatggagtcattgtgat |
24780382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 110 - 171
Target Start/End: Complemental strand, 24789883 - 24789822
Alignment:
| Q |
110 |
ggttttgtagataaaatggttcagcatttggattaagatcataaatacgttgttgcattgtg |
171 |
Q |
| |
|
|||||||| || ||||||||| ||||||||||||||||| | |||| ||||||||||||||| |
|
|
| T |
24789883 |
ggttttgtggaaaaaatggttgagcatttggattaagatgagaaatgcgttgttgcattgtg |
24789822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University