View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13941_low_2 (Length: 306)
Name: NF13941_low_2
Description: NF13941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13941_low_2 |
 |  |
|
| [»] scaffold0100 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0100 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: scaffold0100
Description:
Target: scaffold0100; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 9 - 301
Target Start/End: Original strand, 50140 - 50432
Alignment:
| Q |
9 |
accaccgtgagagagaaacatcaatattgcatcgccgcgccgacgtaagtgtggcgttccggcaggattcttcacgcgaagcttcgccgcctgcggtgtc |
108 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
50140 |
accaccgtgagagagaaacctcaatattgcatcgccgcgccgacgtaagtgtggcgttccggcaggattcttcacgcgaagcttcgccgccggcggtgtc |
50239 |
T |
 |
| Q |
109 |
tcgcgtttgatttcagcatcaatcacactcctacacttgcttgctctgtgagcatagcgcaagcttcgcgagcttgaggttgttgacaaacatgatgtcg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50240 |
tcgcgtttgatttcagcatcaatcacactcctacacttgcttgttctgttagcatagcgcaagcttcgcgagcttgaggttgttgacaaacatgatgtcg |
50339 |
T |
 |
| Q |
209 |
cttcgccggaaaatgaagtcggtgaaaccttcaccgtcgtctcggatttcactttccggtcgccggagcaggaagaagatgtccacactacct |
301 |
Q |
| |
|
| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
50340 |
cctcgccggaaaatgaagtcggtgaaaccttcgccgtcgtctcggatttcactttccggtcgccggagcaggaagaggatgtccacactacct |
50432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University