View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13941_low_4 (Length: 212)
Name: NF13941_low_4
Description: NF13941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13941_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 29 - 195
Target Start/End: Complemental strand, 38515799 - 38515625
Alignment:
| Q |
29 |
cttggcttgcagggtgattctgacttatgattttagagtgtactcctctcataagttttgagt---------ttgattgtgtcaatttaaatgaaaaagt |
119 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| | |
|
|
| T |
38515799 |
cttggcttgcatggtgattctgacttgtgattttagagtgtactcctctcataagttttgagtgttttgagtttgattgtgtcaatttgaatgaaaat-t |
38515701 |
T |
|
| Q |
120 |
ctttaatatacatatgatagagacagttctattcnnnnnnnaaaagtaaccttgttttattacgtatctaaataga |
195 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| ||||||| |||| |
|
|
| T |
38515700 |
ctttaatatacacatgatagagacagttctattctttttttaaaagtaaccttgttttattacatatctaattaga |
38515625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University