View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13942_high_17 (Length: 249)
Name: NF13942_high_17
Description: NF13942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13942_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 10 - 244
Target Start/End: Original strand, 14960197 - 14960435
Alignment:
| Q |
10 |
catctgttactgttgttgtttgcagatacagtggttattgtatcaatagtggtctttgtagctttattcagcatacttggtttatggttcattgttgttc |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14960197 |
catctgttactgttgttgtttgcagatacagtggttattgtttcaatagtggtctttgtagctttattcagcatacttggtttatggttcattgttgttc |
14960296 |
T |
 |
| Q |
110 |
tgagagcaatcaattc--------atggttcccaatcatgagtactgcagttggctaactaacttacttatggacatatttacttggtaacactatttga |
201 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14960297 |
tgagagcaatcaattcatggttgaatggttcccaatcatgagtactgcagttgg----ctaacttacttatggacatatttacttggtaacactatttga |
14960392 |
T |
 |
| Q |
202 |
agtttcttttttatgtaccatgaaaatgaacatgacctatgct |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14960393 |
agtttcttttttatgtaccatgaaaatgaacatgacctttgct |
14960435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University