View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13942_low_15 (Length: 264)
Name: NF13942_low_15
Description: NF13942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13942_low_15 |
 | |
|
| [»] scaffold0294 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 7 - 49
Target Start/End: Original strand, 5380081 - 5380123
Alignment:
| Q |
7 |
ttagaaaggttttaccttccaacaattccctcacttacatatt |
49 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
5380081 |
ttagaaaggttttaccttccaacaattccgtcactttcatatt |
5380123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0294 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0294
Description:
Target: scaffold0294; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 56
Target Start/End: Complemental strand, 12008 - 11958
Alignment:
| Q |
7 |
ttagaaaggttttaccttccaacaattccctcac-ttacatatttcatcca |
56 |
Q |
| |
|
|||||||||||||| | |||||||||||| |||| |||||||||||||||| |
|
|
| T |
12008 |
ttagaaaggttttagcgtccaacaattccgtcactttacatatttcatcca |
11958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University