View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13943_high_33 (Length: 254)
Name: NF13943_high_33
Description: NF13943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13943_high_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 172 - 250
Target Start/End: Complemental strand, 27039062 - 27038984
Alignment:
| Q |
172 |
aaggtaatgtttctataattcatattttgaggcaaaatactcgactacaaccaggttgaagatatctgtctcacacata |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
27039062 |
aaggtaatgtttctataattcatattttgaggcaaaatactcgactacaaccacgttgaagatatctttctcacacata |
27038984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University