View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13943_high_43 (Length: 225)
Name: NF13943_high_43
Description: NF13943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13943_high_43 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 20 - 212
Target Start/End: Original strand, 45668020 - 45668213
Alignment:
| Q |
20 |
gcaacatttgtaaggcatgctgagaattatttgtttgatcattgtaggaagcacagaagaatctaccgcagatttgtactaatcaccttgatcctacatc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45668020 |
gcaacatttgtaaggcatgctgagaattatttgtttgatcattgtaggaagcacagaagaatctaccgcagatttgtactaatcaccttgatcctacatc |
45668119 |
T |
 |
| Q |
120 |
ggtaatcataatcattgataattgatttcaattttgtcaactagtta-ggagtcttagtttcattcgaaagaacagaaaatagatatctctgct |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
45668120 |
ggtaatcataatcattgataattgatttcaattttgtcaactagttagggagtcttagtttcattcaaaagaacagaaaatagatctctctgct |
45668213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University