View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13943_low_25 (Length: 362)
Name: NF13943_low_25
Description: NF13943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13943_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 42 - 352
Target Start/End: Complemental strand, 49661638 - 49661326
Alignment:
| Q |
42 |
atatctttttcatagccaaactttgtaaggtttgtatggatgatgaatttgagaacaattatatgatagtttgtgtgtgataagagtgacacaca--tat |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
49661638 |
atatctttttcatagccaaactttgtaaggtttgtatggatgatgaatttgagaacaattatatgatagtttgtgtgtgataagagtgacacacacatat |
49661539 |
T |
|
| Q |
140 |
acagcatatatagagatattctttacatgctactctcttctcttgccgtcacataatattataatactcattccaaatcatgctttctactttggatttg |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49661538 |
acagcatatatagagatattctttacatgctactctcttctcttgccgtcacataatattataatactcattccaaatcatgctttctactttggatttg |
49661439 |
T |
|
| Q |
240 |
gaatcaaactcaataaccaccctttccttttgcttcaaactcacgcatgttgactttgtttataacctactgcgtctaaaaagcatttcaaattcagcat |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49661438 |
gaatcaaactcaataaccaccctttccttttgcttcaaactcacgcatattgactttgtttataacctactgcgtctaaaaagcatttcaaattcagcat |
49661339 |
T |
|
| Q |
340 |
ataattgcctttg |
352 |
Q |
| |
|
||||||||||||| |
|
|
| T |
49661338 |
ataattgcctttg |
49661326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University