View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13943_low_30 (Length: 316)
Name: NF13943_low_30
Description: NF13943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13943_low_30 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 8e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 16 - 196
Target Start/End: Complemental strand, 53749448 - 53749268
Alignment:
| Q |
16 |
tggtggtggcctttaccttgacacatctgtgatgcaagctgattacagatcttttgttgagattgtcttccaaaacaacgagaacattgttcagagctat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53749448 |
tggtggtggcctttaccttgacacatctgtgatgcaagctgattacagatcttttgttgagattgtcttccaaaacaacgagaacattgttcagagctat |
53749349 |
T |
|
| Q |
116 |
catcttgatggctactctttctttgttgttgggtgagcacactgcacatatttaacttctacttatcctttcactttaatg |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53749348 |
catcttgatggctactctttctttgttgttgggtgagcacactgcacatatttaacttctacttatcctttcactttaatg |
53749268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 69; Significance: 6e-31; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 16 - 152
Target Start/End: Complemental strand, 8570838 - 8570702
Alignment:
| Q |
16 |
tggtggtggcctttaccttgacacatctgtgatgcaagctgattacagatcttttgttgagattgtcttccaaaacaacgagaacattgttcagagctat |
115 |
Q |
| |
|
||||||||| ||||||| ||||| ||||| |||||| |||| |||||| | |||||||||||||| |||||||| |||| |||| ||||||||||| |
|
|
| T |
8570838 |
tggtggtggtatttacctcgacacttctgttatgcaaactgactacagaacatttgttgagattgttttccaaaatgacgaagacatccttcagagctat |
8570739 |
T |
|
| Q |
116 |
catcttgatggctactctttctttgttgttgggtgag |
152 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8570738 |
catctagatggctactctttctttgttgttgggtgag |
8570702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University