View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13943_low_37 (Length: 262)
Name: NF13943_low_37
Description: NF13943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13943_low_37 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 9 - 251
Target Start/End: Original strand, 16737230 - 16737461
Alignment:
| Q |
9 |
gaaatggattctatgaactatcattttcaaacttggaggttgttaggagagttcattccattggttcttggaatctaaactgtggatttatgaatatctt |
108 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
16737230 |
gaaaaggattctatgaactatcattttcaaacttggaggttgttaggagagttcatttcattggttcgtggaatctaaaccgtggatttatgaatatctt |
16737329 |
T |
|
| Q |
109 |
cgtgtggatcggagatttcaattcgttattgcaacaaagaacctaagcacgtgttagtgtaaaattttatggcctttcacaagagtattaacgtccaaag |
208 |
Q |
| |
|
|||||||| ||||||| |||| |||||||||||||||||||| |||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
16737330 |
tgtgtggattagagattttaattaattattgcaacaaagaacctaggcacatg-----------ttttatggcctttcacaagagtattaacgtccaaag |
16737418 |
T |
|
| Q |
209 |
atattgtttgcaatagacagtagtgtaaggactccattagcct |
251 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
16737419 |
atattgtttgcaatagccagtagtgtaaggactccattagcct |
16737461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University