View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13943_low_38 (Length: 254)

Name: NF13943_low_38
Description: NF13943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13943_low_38
NF13943_low_38
[»] chr7 (1 HSPs)
chr7 (172-250)||(27038984-27039062)


Alignment Details
Target: chr7 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 172 - 250
Target Start/End: Complemental strand, 27039062 - 27038984
Alignment:
172 aaggtaatgtttctataattcatattttgaggcaaaatactcgactacaaccaggttgaagatatctgtctcacacata 250  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||    
27039062 aaggtaatgtttctataattcatattttgaggcaaaatactcgactacaaccacgttgaagatatctttctcacacata 27038984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University