View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13943_low_39 (Length: 241)
Name: NF13943_low_39
Description: NF13943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13943_low_39 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 30 - 192
Target Start/End: Complemental strand, 22665241 - 22665079
Alignment:
| Q |
30 |
gataatactatggtggagttggttgaagtttaaactaaaaggatttgagttttccatatctcaatggtgtgtgaaccctggagggtattttttatggtta |
129 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
22665241 |
gataagactatggtggagttggttgaagtttaaacttaaaggatttgagttttccatatctcaatggtgtgtgaaccctggagggtattttttatgatta |
22665142 |
T |
|
| Q |
130 |
tttatgattaggaatcaaactcgatacaatgaagtttataacactgacacattctgtgctata |
192 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
22665141 |
tttatgattaggaatcaaactcgatacaacgaagtttataacagtgacacattctgtgctata |
22665079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University