View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13943_low_42 (Length: 236)
Name: NF13943_low_42
Description: NF13943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13943_low_42 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 12 - 169
Target Start/End: Complemental strand, 34542695 - 34542537
Alignment:
| Q |
12 |
tcatcaacaacgggaacactctcccgcatgactttttatcatcaatattaatttactatctaggagt--ttttgtttggggaatactatttaggagnnnn |
109 |
Q |
| |
|
|||| ||||| ||||||| |||||||| |||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34542695 |
tcataaacaatgggaacattctcccgcgtgactttttatcatcaatattaatttaccatctaggagtttttttgtttggggaatactatttaggag-ttt |
34542597 |
T |
 |
| Q |
110 |
nnnattttcaaacaaaacaaccatttaataattaggaataaatatcaatagcagttcgtt |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34542596 |
tttattttcaaacaaaacaaccatttaataattaggaataaatatcaatagcaattcgtt |
34542537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 156 - 222
Target Start/End: Complemental strand, 34542513 - 34542447
Alignment:
| Q |
156 |
aatagcagttcgttaatataaaccaatagtagnnnnnnnctctcatataaaacaggaaagtattttt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34542513 |
aatagcagttcgttaatataaaccaatagtagtttttttctctcatataaaacaggaaagtattttt |
34542447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University