View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13944_high_20 (Length: 301)
Name: NF13944_high_20
Description: NF13944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13944_high_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 7 - 269
Target Start/End: Original strand, 38765385 - 38765643
Alignment:
| Q |
7 |
actatcatttaatttatgtatggaacgattaatgtttctagctatttggaaaaattgaaaaataaaataatccaacctgaaaggagtggtataggggaaa |
106 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38765385 |
actatcatttaatttatg----gaacgattaatgtttctagctatttggaaaaattgaaaaataaaataatccaacctgaaaggagtggtataggggaaa |
38765480 |
T |
|
| Q |
107 |
atgaattgtccacaattgagatttctctagattaagttcacaatatagtgcttgaaattcatgtgatcaatgatgttgacctcgtgatttaagggagtct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
38765481 |
atgaattgtccacaattgagatttctctggattaaattcacaatatagtgcttgaaattcatgtgatcaatgatgtcgacctcgtgatttaagagagtct |
38765580 |
T |
|
| Q |
207 |
tgatccgcaataacggagcataaccatatatttgaaattaaagtgacatgtacgttcatagat |
269 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38765581 |
tgatccgcaataacggagcataactatatatttgaaattaaagtgacatgtacgttgatagat |
38765643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University