View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13944_high_24 (Length: 236)
Name: NF13944_high_24
Description: NF13944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13944_high_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 52237831 - 52238050
Alignment:
| Q |
1 |
agaacaaaatctattccctggcagacagactctggaagggagctacccataaggtatcaacgataactttttctcatgttggtattaagtattgacaggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52237831 |
agaacaaaatctattccctggcagacagactctggaagggagctacccataaggtatcaacgataactttttctcatgttggtattaagtattgacaggc |
52237930 |
T |
 |
| Q |
101 |
attagagtgcaccaaccatgttgaattgagtccatgcctcctgcattgtaaatacagacttatacattcannnnnnngtaaaaacatgatgaattacaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52237931 |
attagagtgcaccaaccatgttgaattgagtccatgcctcctgcattgtaaatacagacttatacattcatttttttgtaaaaacatgatgaattacaac |
52238030 |
T |
 |
| Q |
201 |
cattaagtagatcagagaat |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
52238031 |
cattaagtagatcagagaat |
52238050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University