View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13945_high_10 (Length: 298)
Name: NF13945_high_10
Description: NF13945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13945_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 4e-78; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 86 - 284
Target Start/End: Original strand, 6624106 - 6624302
Alignment:
| Q |
86 |
cttaatatgcataggtaaattaccaactaaatagtcagtgtcatagtttctccaatcacttcatagattggaatcagctggtacggtgacttagtaatgt |
185 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6624106 |
cttaatatgcataggtaaattaccaaccaaatagtcaatgtcatagtttctccaatcacttcatagattggaatcagctggtacggtgacttgataatgt |
6624205 |
T |
 |
| Q |
186 |
ttaggtttatgagatattgaaccttaaaactgaattgaaagtttagtttgtaactatgccgatagttgttctataaccaccaccgttatttacaatacc |
284 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |||||||||||||||| ||| || |||||||| |
|
|
| T |
6624206 |
ttaggtttaggagatattgaaccttaaaactgaattgaaagtttagtttgtaactgtgcc--tagtggttctataaccaccacagttgttgacaatacc |
6624302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 106 - 180
Target Start/End: Original strand, 1568781 - 1568856
Alignment:
| Q |
106 |
taccaactaaatagtcagtgtcatagtttc-tccaatcacttcatagattggaatcagctggtacggtgacttagt |
180 |
Q |
| |
|
|||||||||| || |||||||||||| ||| |||||| |||||| ||||||||| || ||| || ||||||||||| |
|
|
| T |
1568781 |
taccaactaagtaatcagtgtcataggttcctccaataacttcagagattggaaccaactgataaggtgacttagt |
1568856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 15 - 50
Target Start/End: Original strand, 6624034 - 6624069
Alignment:
| Q |
15 |
aaaaacaaagttaactatacatgtgttaacatgatt |
50 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6624034 |
aaaaacaaagttaactatacatgtgttgacatgatt |
6624069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 106 - 180
Target Start/End: Complemental strand, 33777576 - 33777501
Alignment:
| Q |
106 |
taccaactaaatagtcagtgtcatagtttc-tccaatcacttcatagattggaatcagctggtacggtgacttagt |
180 |
Q |
| |
|
|||||||||| || |||||||||||| ||| |||||| |||||| ||||||||| || ||| || ||||||||||| |
|
|
| T |
33777576 |
taccaactaagtaatcagtgtcataggttcctccaataacttcagagattggaaccaactgataaggtgacttagt |
33777501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University