View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13945_high_14 (Length: 271)
Name: NF13945_high_14
Description: NF13945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13945_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 6e-43; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 24 - 148
Target Start/End: Original strand, 56442870 - 56442989
Alignment:
| Q |
24 |
acggaaacgacaatgagcagcagcatctcactcctatcgctgctgctgccatcacccctcactccttgccacgttgcagatttacttggattggattgga |
123 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| ||||||||||||| |||||| |||||||||| |
|
|
| T |
56442870 |
acggaaacgacaatgagcagcagcacctcactcctatcgctactgctgccatcacccctcactctttgccacgttgcaaatttac-----ttggattgga |
56442964 |
T |
 |
| Q |
124 |
ttggattcatgcattgcatacttca |
148 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
56442965 |
ttggattcatgcattgcatacttca |
56442989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University